Yehuda/pysbol2 sequence constraint

examples/sbol2/CreatingSBOL2Objects/SequenceConstraint.ipynb

@@ -0,0 +1,161 @@
+{
+ "cells": [
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "## Using `SequenceConstraint` to place restrictions on `Components` within the same `ComponentDefinition`\n",
+    "\n",
+    "`SequenceConstraints` are used to describe the relative position and orientation between two components within the same `ComponentDefinition`. \n",
+    "\n",
+    "A minimally useful version of this object requires the existence of:\n",
+    "\n",
+    "- a parent ComponentDefinition\n",
+    "- Two child Components\n",
+    "\n",
+    "### Four Restriction Types:\n",
+    "1. `SBOL_RESTRICTION_PRECEDES`: `Component_A` precedes `Component_B` \n",
+    "2. `SBOL_RESTRICTION_SAME_ORIENTATION_AS`: The two `Components` have the same orrientation as each other\n",
+    "3. `SBOL_RESTRICTION_OPPOSITE_ORIENTATION_AS`: The two `Components` have the opposite orrientation as each other\n",
+    "4. `SBOL_RESTRICTION_DIFFERENT_FROM`: The two `Components` do not refer to the same `ComponentDefinition`\n",
+    "\n",
+    "For more information on the `SequenceConstraint` class and its properties, check out page 36 of the [SBOL 2.3.0 specifications](https://sbolstandard.org/docs/SBOL2.3.0.pdf).\n",
+    "\n",
+    "We will demonstrate `SBOL_RESTRICTION_PRECEDES` using the [Part:BBa_K174004](https://parts.igem.org/Part:BBa_K174004), a pspac promoter, designed by the The Newcastle 2009 iGEM team. The genetic device has two parts, a pspac promoter and a Lac operator, with the promoter directly preceding the operator. We can use `SBOL_RESTRICTION_PRECEDES` to model this relationship."
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 2,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "import sbol2\n",
+    "import sbol2.sequenceconstraint\n",
+    "\n",
+    "# Create a new SBOL document\n",
+    "doc = sbol2.Document()\n",
+    "\n",
+    "# Set the homespace (namespace) for the document\n",
+    "sbol2.setHomespace('https://github.com/SynBioDex/SBOL-Notebooks')\n",
+    "\n",
+    "\n",
+    "# Create a ComponentDefinition for the LacI operator\n",
+    "lacI_operator_comp_def = sbol2.ComponentDefinition('LacI_operator', sbol2.BIOPAX_DNA)\n",
+    "lacI_operator_comp_def.description = 'LacI binding site'\n",
+    "# The role \"SO:0000057\" is for an operator, as defined in the Sequence Ontology\n",
+    "lacI_operator_comp_def.roles = [\"http://identifiers.org/so/SO:0000057\"]\n",
+    "doc.addComponentDefinition(lacI_operator_comp_def)\n",
+    "\n",
+    "# Create a ComponentDefinition for the pspac promoter\n",
+    "pspac_promotor_comp_def = sbol2.ComponentDefinition('pspac', sbol2.BIOPAX_DNA)\n",
+    "pspac_promotor_comp_def.roles = [sbol2.SO_PROMOTER]\n",
+    "doc.addComponentDefinition(pspac_promotor_comp_def)\n",
+    "\n",
+    "# Create a ComponentDefinition for the genetic part\n",
+    "genetic_part_comp_def = sbol2.ComponentDefinition('BBa_K174004', sbol2.BIOPAX_DNA)\n",
+    "genetic_part_comp_def.description = 'pspac core promoter region'\n",
+    "genetic_part_comp_def.roles = [sbol2.SO_PROMOTER]\n",
+    "doc.addComponentDefinition(genetic_part_comp_def)\n",
+    "\n",
+    "# Create a Component instance for the pspac promoter and add it to the genetic part\n",
+    "pspac_promoter_comp = sbol2.Component('pspac')\n",
+    "pspac_promoter_comp.definition = pspac_promotor_comp_def.identity\n",
+    "genetic_part_comp_def.components.add(pspac_promoter_comp)\n",
+    "\n",
+    "# Create a Component instance for the LacI operator and add it to the genetic part\n",
+    "LacI_operator_comp = sbol2.Component('LacI_operator')\n",
+    "LacI_operator_comp.definition = lacI_operator_comp_def.identity\n",
+    "genetic_part_comp_def.components.add(LacI_operator_comp)\n",
+    "\n",
+    "# Create a SequenceConstraint specifying that the pspac promoter precedes the LacI operator\n",
+    "constraint = genetic_part_comp_def.sequenceConstraints.create('Constraint1')\n",
+    "constraint.subject = pspac_promoter_comp.identity  # Set the subject to the identity of pspac promoter\n",
+    "constraint.object = LacI_operator_comp.identity    # Set the object to the identity of LacI operator\n",
+    "constraint.restriction = sbol2.SBOL_RESTRICTION_PRECEDES  # Use the SBOL_RESTRICTION_PRECEDES restriction\n"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "As you can see, creating a `SequenceConstraint` is very easy, as all that is needed are two `Components` within the same parent `ComponentDefinition`. For our next step, we will show off some of the functionality of `SequenceConstraint`. One useful aspect of `SequenceConstraint` is that if we have specified the `Sequences` of the individual Components we can calculate the `Sequence` of the entire Genetic part."
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 3,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# Create the pspac sequence\n",
+    "pspac_sequence = sbol2.Sequence('pspac_sequence')\n",
+    "pspac_sequence.elements = 'ttgttgactttatctacaaggtgtggcataatgtgtgg'\n",
+    "pspac_sequence.encoding = sbol2.SBOL_ENCODING_IUPAC\n",
+    "pspac_promotor_comp_def.sequence = pspac_sequence\n",
+    "\n",
+    "# Create the LacI sequence\n",
+    "LacI_sequence = sbol2.Sequence('LacI_sequence')\n",
+    "LacI_sequence.elements = 'attgtgagcgctcacaatt'\n",
+    "LacI_sequence.encoding = sbol2.SBOL_ENCODING_IUPAC\n",
+    "lacI_operator_comp_def.sequence = LacI_sequence"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 5,
+   "metadata": {},
+   "outputs": [
+    {
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "<bound method ComponentDefinition.compile of <sbol2.componentdefinition.ComponentDefinition object at 0x0000023F6B6D3DF0>>\n"
+     ]
+    },
+    {
+     "data": {
+      "text/plain": [
+       "'Valid.'"
+      ]
+     },
+     "execution_count": 5,
+     "metadata": {},
+     "output_type": "execute_result"
+    }
+   ],
+   "source": [
+    "print(genetic_part_comp_def.compile)\n",
+    "\n",
+    "\n",
+    "\n",
+    "# Validate the document to ensure compliance with SBOL standards\n",
+    "doc.validate()\n",
+    "\n",
+    "# Save the document to an SBOL file\n",
+    "doc.write('sequence_constraint_example.xml')"
+   ]
+  }
+ ],
+ "metadata": {
+  "kernelspec": {
+   "display_name": "SBOL-test",
+   "language": "python",
+   "name": "python3"
+  },
+  "language_info": {
+   "codemirror_mode": {
+    "name": "ipython",
+    "version": 3
+   },
+   "file_extension": ".py",
+   "mimetype": "text/x-python",
+   "name": "python",
+   "nbconvert_exporter": "python",
+   "pygments_lexer": "ipython3",
+   "version": "3.10.14"
+  }
+ },
+ "nbformat": 4,
+ "nbformat_minor": 2
+}